TimelyScholarFree Tools › Primer Tm Calculator
Calculate the melting temperature of PCR primers with the nearest-neighbour thermodynamic method, corrected for sodium, magnesium and dNTP concentrations, and compare it with simpler formulas.
FreeNo account neededYour data stays in your browser
| Primer | Length | GC % | Tm, nearest-neighbour | Tm, %GC formula | Tm, Wallace rule |
|---|---|---|---|---|---|
| AGCGGATAACAATTTCACACAGGA | 24 | 41.7 | 58.3 °C | 52.0 °C | 68 °C |
| GTAAAACGACGGCCAGT | 17 | 52.9 | 53.9 °C | 46.3 °C | 52 °C |
Tm difference between the two primers: 4.5 °C (nearest-neighbour).
The nearest-neighbour method (Allawi & SantaLucia parameters, SantaLucia salt correction, Mg²⁺ as a sodium equivalent) is the most accurate here. The %GC formula and the Wallace rule (a rough rule of thumb for short primers) are shown for comparison. Results match Biopython's MeltingTemp module.
One per line, 5′ to 3′.
Na⁺, Mg²⁺, dNTPs and primer concentration.
Across methods and between the primers in a pair.
The melting temperature (Tm) is the temperature at which half of the primer is bound to its target. The nearest-neighbour method sums the enthalpy and entropy of each adjacent base pair and is the most accurate of the common methods.
Salt stabilises the duplex, so Tm depends on the reaction buffer. Magnesium is converted to a sodium equivalent after allowing for dNTPs, which bind magnesium.
The %GC formula and the Wallace rule are simpler approximations; the Wallace rule is a rough rule of thumb for short primers.
They use different thermodynamic tables, salt corrections and default concentrations. Compare primers with the same method and conditions.
Use the free Mg²⁺ in your PCR buffer and your dNTP concentration; the 'Typical PCR buffer' button fills in common values.