TimelyScholarFree Tools › Reverse Complement Tool
Paste one or more sequences (plain text or FASTA) to get the reverse complement, the reverse or the complement, with IUPAC ambiguity codes handled correctly.
FreeNo account neededYour data stays in your browser
>example_sequence (synthetic) reverse complement ACCTTAGCTCCAGAGTGAACCTTAGGATCGTTGAGCAAGATTGCATTCTCGACCAACGGT TCTTTCGTTCATATCGGTGTTTGAACAACACAATACAACATGCTCTTCGCTGAATGGCGC TGACCTCAAAGTGTTTCGCGGAACTCGCCAAGCACCTGTCGGAAGACCCAAACATGTATG TGACAAGGGTTGATTTTCCATTTCCGTGTTAGAGCTGGACAACTCGTACGCGCCTGAAAA TGAGAC
Ambiguity codes are complemented too (R↔Y, K↔M, B↔V, D↔H; S, W and N stay the same).
Plain text or FASTA; several records are fine.
Reverse complement, reverse or complement; DNA or RNA.
As plain sequence or FASTA.
DNA is double-stranded and the two strands run in opposite directions. The reverse complement of a sequence is the sequence of the opposite strand, read 5′ to 3′: each base is replaced by its partner (A↔T, C↔G) and the order is reversed.
Reverse complements are needed for designing reverse primers, reading sequences from the other strand and searching both strands for motifs.
Reverse only reverses the order of the letters; reverse complement also swaps each base for its partner, giving the opposite strand.